| Internal ID | 18984644 | Source Database | TransTermHP TERM 22 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 22
|
| Sequence |
GCCCTGCTGCGCTCGCGTCAGGGC Look for more occurrences |
| Start | 70865 |
| End | 70888 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU12597 Contig_2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCAGCTCTCAAAAA(5' tail) GCCCTGCTGC(5' stem) GCTC(loop) GCGTCAGGGC(3' stem) TTTTTTTACGACTAT(3' tail). Confidence: 100. opp_overlap 70854 70865 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|