| Internal ID | 18979410 | Source Database | TransTermHP TERM 110 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 110
|
| Sequence |
GGCTGCCCCCACGGGCAGCC Look for more occurrences |
| Start | 335968 |
| End | 335987 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU11164 Contig_47, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACGCTGACCTTGAAA(5' tail) GGCTGCCC(5' stem) CCAC(loop) GGGCAGCC(3' stem) TTTTTTTGTGGCCGG(3' tail). Confidence: 100. opp_overlap 335955 335968 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|