| Internal ID | 18978281 | Source Database | TransTermHP TERM 37 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 37
|
| Sequence |
CCCGTCACGGTCAACCGGACGGG Look for more occurrences |
| Start | 153521 |
| End | 153543 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU11235 Contig_37, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCATCATCGTTCAA(5' tail) CCCGTCACGG(5' stem) TCAA(loop) CCG-GACGGG(3' stem) TTTGTTTGTTTCTGG(3' tail). Confidence: 100. gap 1 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|