Internal ID | 18977058 | Source Database | TransTermHP TERM 29 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 29
|
Sequence |
CCCGTCACGGTCAACCGGACGGG Look for more occurrences |
Start | 133041 |
End | 133063 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas fluorescens strain AU7350 Contig_17, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGCATCATCGTTCAA(5' tail) CCCGTCACGG(5' stem) TCAA(loop) CCG-GACGGG(3' stem) TTTGTTTGTTTCTGG(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|