| Internal ID | 18970523 | Source Database | TransTermHP TERM 241 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 241
|
| Sequence |
CGCGGCGCCCTCACAGGTGCCGCG Look for more occurrences |
| Start | 762530 |
| End | 762553 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain C3 FCC4LTTACXX-wHAIPI007897-94_L5_1_(paired)_contig_2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCACCATAAAAAAA(5' tail) CGCGGCACC(5' stem) TGTGAG(loop) GGCGCCGCG(3' stem) TTTTTTGTGCCTGCT(3' tail). Confidence: 100. opp_overlap 762530 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|