| Internal ID | 18967891 | Source Database | TransTermHP TERM 1336 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1336
|
| Sequence |
GCCGATCCATTTATGGGTCGGC Look for more occurrences |
| Start | 6128679 |
| End | 6128700 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens PICF7, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGTTGTTATCAA(5' tail) GCCGATCCA(5' stem) TTTA(loop) TGGGTCGGC(3' stem) TTTTTTATTGCCTGG(3' tail). Confidence: 100. opp_overlap 6128679 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|