| Internal ID | 18967799 | Source Database | TransTermHP TERM 1199 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1199
|
| Sequence |
CGGCCCGCCTTTTGGTGGGCCG Look for more occurrences |
| Start | 5418664 |
| End | 5418685 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens PICF7, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGATGGTCTAAACGA(5' tail) CGGCCCGCC(5' stem) TTTT(loop) GGTGGGCCG(3' stem) TTGTGCATGTGATGA(3' tail). Confidence: 95. opp_overlap 5418661 5418664, overlap 5418662 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|