Internal ID | 18967742 | Source Database | TransTermHP TERM 1111 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1111
|
Sequence |
CCCCATGATCGCTCATGGGG Look for more occurrences |
Start | 4846872 |
End | 4846891 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens PICF7, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AAGCCGCAATGAAAA(5' tail) CCCCATGA(5' stem) GCGA(loop) TCATGGGG(3' stem) TTTTTTTCGTTATAG(3' tail). Confidence: 95. opp_overlap 4846872 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|