| Internal ID | 18965276 | Source Database | TransTermHP TERM 435 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 435
|
| Sequence |
GCCGATCCATTTATGGGTCGGC Look for more occurrences |
| Start | 1862320 |
| End | 1862341 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain PCL1751, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCAGGCAATAAAAAA(5' tail) GCCGACCCA(5' stem) TAAA(loop) TGGATCGGC(3' stem) TTGATAACAACCCCG(3' tail). Confidence: 100. opp_overlap 1862320 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|