| Internal ID | 18965206 | Source Database | TransTermHP TERM 345 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 345
|
| Sequence |
CCGCTTCCCTCACCGGAAGCGG Look for more occurrences |
| Start | 1500464 |
| End | 1500485 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain PCL1751, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGAGGCATAAAAAAA(5' tail) CCGCTTCC(5' stem) GGTGAG(loop) GGAAGCGG(3' stem) TTTTTTTTGCAGCGG(3' tail). Confidence: 100. opp_overlap 1500464, overlap 1500452 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|