Internal ID | 18962114 | Source Database | TransTermHP TERM 51 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 51
|
Sequence |
GGCGCCCTGCAACAGGCGCC Look for more occurrences |
Start | 259180 |
End | 259199 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens strain MEP34 contig_38, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCCGGCCGTGAAAAA(5' tail) GGCG-CCTG(5' stem) TTG(loop) CAGGGCGCC(3' stem) TTTTTCATTTGGGAA(3' tail). Confidence: 91. gap 1, opp_overlap 259180 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|