| Internal ID | 18955062 | Source Database | TransTermHP TERM 671 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 671
|
| Sequence |
TGGAGCGTGCGAACGCTCCA Look for more occurrences |
| Start | 3687081 |
| End | 3687100 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens PA4C2 scaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGATCTGAACGAA(5' tail) TGGAGCGT(5' stem) GCGA(loop) ACGCTCCA(3' stem) TTTTTGTTTCTGGCG(3' tail). Confidence: 100. opp_overlap 3687081 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|