| Internal ID | 18954790 | Source Database | TransTermHP TERM 265 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 265
|
| Sequence |
CCCCATGAGCGATCATGGGG Look for more occurrences |
| Start | 1606040 |
| End | 1606059 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens PA4C2 scaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGAGCATAAAAAAA(5' tail) CCCCATGA(5' stem) TCGC(loop) TCATGGGG(3' stem) TTTTTCATTTTCAGC(3' tail). Confidence: 100. opp_overlap 1606040 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|