| Internal ID | 18954044 | Source Database | TransTermHP TERM 637 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 637
|
| Sequence |
CTGACGTCGCCCCTGGCGGCGTCAG Look for more occurrences |
| Start | 2980646 |
| End | 2980670 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain UK4, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TAAGAGAGCCACAAC(5' tail) CTGACGTCGCC(5' stem) CCT(loop) GGCGGCGTCAG(3' stem) ATTTTGCTACCTTGC(3' tail). Confidence: 100. opp_overlap 2980646 2980645, overlap 2980645 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|