| Internal ID | 18935703 | Source Database | TransTermHP TERM 469 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 469
|
| Sequence |
GGCCAGCTTTTTAGCTGGCC Look for more occurrences |
| Start | 1472814 |
| End | 1472833 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas deceptionensis strain DSM 26521 1_1862075_38.8261, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AATCCGTGACCATAA(5' tail) GGCCAGCT(5' stem) TTTT(loop) AGCTGGCC(3' stem) TTATCTCTATAAGGC(3' tail). Confidence: 100. opp_overlap 1472814, overlap 1472805 1472811 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|