| Internal ID | 18933417 | Source Database | TransTermHP TERM 826 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 826
|
| Sequence |
GGCCGACCCGTTCGCACGGGTCGGCC Look for more occurrences |
| Start | 3598183 |
| End | 3598208 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas cichorii JBC1, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGTTATTGAAAA(5' tail) GGCCGACCCGT(5' stem) TCGC(loop) ACGGGTCGGCC(3' stem) TTTTTATTGCCTGCG(3' tail). Confidence: 100. opp_overlap 3598183, overlap 3598177 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|