| Internal ID | 18931063 | Source Database | TransTermHP TERM 284 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 284
|
| Sequence |
CGGAGCGTGCGAACGCTCCG Look for more occurrences |
| Start | 1036035 |
| End | 1036054 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas chlororaphis strain PCL1606, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTCGGAAACAAAAA(5' tail) CGGAGCGT(5' stem) TCGC(loop) ACGCTCCG(3' stem) TTTTTCGTCCAGGCC(3' tail). Confidence: 100. opp_overlap 1036035 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|