| Internal ID | 18931024 | Source Database | TransTermHP TERM 225 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 225
|
| Sequence |
CCGGCGCCGCACTGGCGCCGG Look for more occurrences |
| Start | 862790 |
| End | 862810 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas chlororaphis strain PCL1606, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCATGTAGCGTAAAA(5' tail) CCGGCGCCA(5' stem) GTG(loop) CGGCGCCGG(3' stem) TTTTTGCCGGGGAGA(3' tail). Confidence: 100. opp_overlap 862790 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|