| Internal ID | 18930194 | Source Database | TransTermHP TERM 61 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 61
|
| Sequence |
CAAAGGCCACCTTCGGGTGGCCTTTG Look for more occurrences |
| Start | 266833 |
| End | 266858 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas chlororaphis subsp. aureofaciens NBRC 3521, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTGCAACTCTGCTGA(5' tail) CAAAGGCCACC(5' stem) TTCG(loop) GGTGGCCTTTG(3' stem) TTCGTTAAGAGCAGT(3' tail). Confidence: 91. opp_overlap 266837, overlap 266837 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|