| Internal ID | 18927385 | Source Database | TransTermHP TERM 245 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 245
|
| Sequence |
CGGGAGTCCCCACGGGCTCCCG Look for more occurrences |
| Start | 977010 |
| End | 977031 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas brassicacearum strain PA1G7 Scaffold3, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAGGCATAAAAAAA(5' tail) CGGGAGCCC(5' stem) GTGG(loop) GGACTCCCG(3' stem) TTTTTTGACAGTTCA(3' tail). Confidence: 100. opp_overlap 977010 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|