| Internal ID | 18925816 | Source Database | TransTermHP TERM 96 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 96
|
| Sequence |
GCCCGGCCTTCTGGTCGGGC Look for more occurrences |
| Start | 444691 |
| End | 444710 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas brassicacearum PP1_210F scaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AAAACTCAAAAAAAA(5' tail) GCCCGACC(5' stem) AGAA(loop) GGCCGGGC(3' stem) GCTTTTCTTGGCAAT(3' tail). Confidence: 100. opp_overlap 444691 444690 444689 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|