| Internal ID | 18925717 | Source Database | TransTermHP TERM 1269 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1269
|
| Sequence |
CGGCGCAGCCCTCCCCCGCTGCGCCG Look for more occurrences |
| Start | 6445276 |
| End | 6445301 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas brassicacearum strain DF41, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGAGTAATAAGCC(5' tail) CGGCGCAGC(5' stem) CCTCCCCC(loop) GCTGCGCCG(3' stem) TTTTCGTTCTGAAAG(3' tail). Confidence: 95. opp_overlap 6445274 6445273 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|