Internal ID | 18923697 | Source Database | TransTermHP TERM 258 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 258
|
Sequence |
TGCCCGTTTCGTCAGAACGGGCA Look for more occurrences |
Start | 1164376 |
End | 1164398 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas balearica DSM 6083, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTCTTAAACGAAAAA(5' tail) TGCCCGTTC(5' stem) TGACG(loop) AAACGGGCA(3' stem) TTTTTCGGACGCTGG(3' tail). Confidence: 100. opp_overlap 1164376 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|