| Internal ID | 18921207 | Source Database | TransTermHP TERM 40 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 40
|
| Sequence |
GCGACCTTGCACCGCGGTCGC Look for more occurrences |
| Start | 150873 |
| End | 150893 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas amygdali pv. tabaci str. ATCC 11528 scaffold6.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGTCAGCAAAAAAAA(5' tail) GCGACCGCG(5' stem) GTG(loop) CAAGGTCGC(3' stem) CTTTTCTGTTTTGAA(3' tail). Confidence: 100. opp_overlap 150873 150872 150867 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|