| Internal ID | 18915509 | Source Database | TransTermHP TERM 65 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 65
|
| Sequence |
CAGGGCGGACCTTCGGGTTGCCCTG Look for more occurrences |
| Start | 299285 |
| End | 299309 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas alkylphenolia strain KL28, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCAGTCACTGCAAG(5' tail) CAGGGCGGACC(5' stem) TTC(loop) GGGTTGCCCTG(3' stem) TTTTTGCGTGTGCCG(3' tail). Confidence: 91. opp_overlap 299287 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|