| Internal ID | 18914643 | Source Database | TransTermHP TERM 262 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 262
|
| Sequence |
GGGGGCGCCGCATGGCGCCCCC Look for more occurrences |
| Start | 837402 |
| End | 837423 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain F9676, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGTAAATGACAAC(5' tail) GGGGGCGCC(5' stem) GCAT(loop) GGCGCCCCC(3' stem) TATACTTTCCGCTTT(3' tail). Confidence: 91. opp_overlap 837402 837401 837395, overlap 837397 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|