Internal ID | 18675913 | Source Database | TransTermHP TERM 80 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 80
|
Sequence |
CGGGGCGGCTATAATCGCCGCCCCG Look for more occurrences |
Start | 238456 |
End | 238480 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain UM-01, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGGCAGCGGGAAAA(5' tail) CGGGGCGGCGA(5' stem) TTA(loop) TAGCCGCCCCG(3' stem) CAGGCATCGGAAAGC(3' tail). Confidence: 100. overlap 238472 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|