| Internal ID | 18658625 | Source Database | TransTermHP TERM 103 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 103
|
| Sequence |
GGGGGCGCCGCATGGCGCCCCC Look for more occurrences |
| Start | 240314 |
| End | 240335 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa MRSN 317 contig5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGTAAATGACAAC(5' tail) GGGGGCGCC(5' stem) GCAT(loop) GGCGCCCCC(3' stem) TGTGCTTTCCGTTTT(3' tail). Confidence: 91. opp_overlap 240314 240313 240307, overlap 240309 240301 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|