Internal ID | 18649838 | Source Database | TransTermHP TERM 696 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 696
|
Sequence |
GGGCCGGCGCGAAATGCGTCGGCCC Look for more occurrences |
Start | 2702218 |
End | 2702242 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa DNA, complete genome, strain: NCGM 1984. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GACGCCTGAAGCGAC(5' tail) GGGCCGGCGCG(5' stem) AAA(loop) TGCGTCGGCCC(3' stem) TTTTCGGAAAAAGGA(3' tail). Confidence: 100. opp_overlap 2702217 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|