Internal ID | 18641288 | Source Database | TransTermHP TERM 6 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 6
|
Sequence |
GCCCCGGCCAAGCGCCGGGGC Look for more occurrences |
Start | 18557 |
End | 18577 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain Liverpool Epidemic Strain, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GACGGGAACGAAAAA(5' tail) GCCCCGGC(5' stem) GCTTG(loop) GCCGGGGC(3' stem) TTTCCTGGGACGGGA(3' tail). Confidence: 100. opp_overlap 18557 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|