Internal ID | 18627382 | Source Database | TransTermHP TERM 1 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1
|
Sequence |
GGCCCGCGCGTCCGCGCGGGCC Look for more occurrences |
Start | 4846 |
End | 4867 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain Liverpool Epidemic Strain, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AAGCGATACCCCCGA(5' tail) GGCCCGCGC(5' stem) GTCC(loop) GCGCGGGCC(3' stem) TTTCTTTCAGAGGCT(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|