| Internal ID | 18593775 | Source Database | TransTermHP TERM 170 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 170
|
| Sequence |
AGGGCCTCGTCCGAGGCCCC Look for more occurrences |
| Start | 742820 |
| End | 742839 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14379 AZPAE14379_contig_1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGCGCAACGAAAAA(5' tail) AGGGCCTC(5' stem) GTCC(loop) GAGGCCCC(3' stem) TTTTCTTTTCCGGCG(3' tail). Confidence: 100. opp_overlap 742821, overlap 742815 742821 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|