| Internal ID | 18592227 | Source Database | TransTermHP TERM 24 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 24
|
| Sequence |
GCGCCAGGCTGTCGCCTGGCGG Look for more occurrences |
| Start | 41015 |
| End | 41036 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14372 AZPAE14372_contig_37, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCAACAGATGTGAG(5' tail) GCGCCAGGC(5' stem) TGTC(loop) GCCTGGCGG(3' stem) TTTTTCTCGTATATT(3' tail). Confidence: 100. overlap 41016 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|