| Internal ID | 18591996 | Source Database | TransTermHP TERM 12 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 12
|
| Sequence |
GAAGCCCCGCCATAGCGGGGCTTC Look for more occurrences |
| Start | 34807 |
| End | 34830 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14372 AZPAE14372_contig_29, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGATTCGATAAAA(5' tail) GAAGCCCCGC(5' stem) CATA(loop) GCGGGGCTTC(3' stem) TTGTTTTCACGCGAG(3' tail). Confidence: 100. opp_overlap 34807, overlap 34810 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|