| Internal ID | 18568256 | Source Database | TransTermHP TERM 75 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 75
|
| Sequence |
GAATGACTGGAAACAGGCATTC Look for more occurrences |
| Start | 341894 |
| End | 341915 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE15065 AZPAE15065_contig_27, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGATCTGACAAAAA(5' tail) GAATGCCTG(5' stem) TTTC(loop) CAGTCATTC(3' stem) GCGTTACGTGCACCG(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|