Internal ID | 18562315 | Source Database | TransTermHP TERM 10 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 10
|
Sequence |
GCCGCCGGCCACAGGGCCGGCGGC Look for more occurrences |
Start | 79734 |
End | 79757 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14980 AZPAE14980_contig_7, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCTAGTCAGTGAGAA(5' tail) GCCGCCGGCC(5' stem) CTGT(loop) GGCCGGCGGC(3' stem) GGAAGCATTCGGGGC(3' tail). Confidence: 95. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|