| Internal ID | 18562115 |
| Source Database | TransTermHP TERM 12 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 12
|
| Sequence |
AAGCCCGCCTTCAGGCGGGCTC Look for more occurrences |
| Start | 78603 |
| End | 78624 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14980 AZPAE14980_contig_38, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGTACAGAAACAAA(5' tail) GAGCCCGCC(5' stem) TGAA(loop) GGCGGGCTT(3' stem) TGAACGGAACGGACC(3' tail). Confidence: 93. opp_overlap 78605, overlap 78605 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|