Internal ID | 18562070 | Source Database | TransTermHP TERM 26 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 26
|
Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
Start | 109707 |
End | 109731 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14980 AZPAE14980_contig_31, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGCGATGGAACGAA(5' tail) GAACCCCGGC(5' stem) CATGA(loop) GCCGGGGTTC(3' stem) TTCGTTCCTGATTGC(3' tail). Confidence: 93. opp_overlap 109707 109703 109710, overlap 109703 109699 109710 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|