| Internal ID | 18538513 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
GGCCGCTGATACCAGCGGCC Look for more occurrences |
| Start | 13900 |
| End | 13919 |
| Strand | + |
| Genomic Context | Located within gene [D407_RS25940] |
| Replicon | Pseudomonas aeruginosa strain P7-L633/96 contig59, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGACGTCTTCTCAA(5' tail) GGCCGCTG(5' stem) ATAC(loop) CAGCGGCC(3' stem) TTTTTTTTCGGGTTG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|