| Internal ID | 18534820 | Source Database | TransTermHP TERM 224 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 224
|
| Sequence |
GGGCATGAAACTCCATTTCCATGCCC Look for more occurrences |
| Start | 776913 |
| End | 776938 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain PSE305. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGATAAAAACAAA(5' tail) GGGCATGGAA(5' stem) ATGGAG(loop) TTTCATGCCC(3' stem) TTGTCGGCTGAATGA(3' tail). Confidence: 90. opp_overlap 776913 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|