| Internal ID | 18532254 | Source Database | TransTermHP TERM 1068 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1068
|
| Sequence |
GCGCCAGGCTGTCGCCTGGCGG Look for more occurrences |
| Start | 4718164 |
| End | 4718185 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA96. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AATATACGAGAAAAA(5' tail) CCGCCAGGC(5' stem) GACA(loop) GCCTGGCGC(3' stem) CTCACATCTGTTGCA(3' tail). Confidence: 100. overlap 4718165 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|