Internal ID | 18531270 | Source Database | TransTermHP TERM 1107 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1107
|
Sequence |
GCGCCAGGCTGTCGCCTGGCGG Look for more occurrences |
Start | 4804531 |
End | 4804552 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa LESlike1 sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AATATACGAGAAAAA(5' tail) CCGCCAGGC(5' stem) GACA(loop) GCCTGGCGC(3' stem) CTCACATCTGTTGCA(3' tail). Confidence: 100. overlap 4804532 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|