Internal ID | 18530277 | Source Database | TransTermHP TERM 1048 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1048
|
Sequence |
GGCCGGGGAGCGCTGCTCCCCGGCC Look for more occurrences |
Start | 4403756 |
End | 4403780 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa YL84, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCTCGTAACGAAAAA(5' tail) GGCCGGGGAGC(5' stem) GCT(loop) GCTCCCCGGCC(3' stem) TTTTTTCGTCGACAT(3' tail). Confidence: 100. opp_overlap 4403756 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|