| Internal ID | 18529540 | Source Database | TransTermHP TERM 69 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 69
|
| Sequence |
GGGGGCGCCGCATGGCGCCCCC Look for more occurrences |
| Start | 237449 |
| End | 237470 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA037 adkgb-supercont1.8, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AAAGCGGAAAGTATA(5' tail) GGGGGCGCC(5' stem) ATGC(loop) GGCGCCCCC(3' stem) GTTGTCATTTACGCT(3' tail). Confidence: 91. opp_overlap 237449 237448 237443, overlap 237444 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|