Internal ID | 18514329 | Source Database | TransTermHP TERM 27 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 27
|
Sequence |
GCCCCGGTGTCGCGAGACGCCGGGGC Look for more occurrences |
Start | 111359 |
End | 111384 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas oryzihabitans NBRC 102199, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGCGCATTGAAAAA(5' tail) GCCCCGGTGTC(5' stem) GCGA(loop) GACGCCGGGGC(3' stem) TTTTTCTTGTCCGTG(3' tail). Confidence: 100. opp_overlap 111359 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|