Internal ID | 18511685 | Source Database | TransTermHP TERM 566 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 566
|
Sequence |
GGCCGGCCGCCTCCGGGCGCCCGGCC Look for more occurrences |
Start | 1920662 |
End | 1920687 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. M1 PM1contig_002, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCCCGCCTGACAAAA(5' tail) GGCCGGCCGCC(5' stem) TCCG(loop) GGCGCCCGGCC(3' stem) TTTTTCATGTCCATA(3' tail). Confidence: 100. opp_overlap 1920662 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|