Internal ID | 18509961 | Source Database | TransTermHP TERM 49 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 49
|
Sequence |
GCCCTGACGCTCACGCGCCAGGGC Look for more occurrences |
Start | 164261 |
End | 164284 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas syringae strain B576 contig_4, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCGTCGACTAAAAAA(5' tail) GCCCTGACGC(5' stem) TCAC(loop) GCGCCAGGGC(3' stem) TTTTTTCATATCACG(3' tail). Confidence: 100. opp_overlap 164261 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|