Internal ID | 18509416 | Source Database | TransTermHP TERM 231 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 231
|
Sequence |
GCCGACCCGTTACCGGGTCGGC Look for more occurrences |
Start | 1390057 |
End | 1390078 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas syringae strain B576 contig_11, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGGATTATTGAAA(5' tail) GCCGACCCG(5' stem) GTAA(loop) CGGGTCGGC(3' stem) TTTTTTTTGCCTGTT(3' tail). Confidence: 100. opp_overlap 1390057 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|