| Internal ID | 18508472 | Source Database | TransTermHP TERM 1362 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1362
|
| Sequence |
TCCGCGTTAAACTGCGCGGG Look for more occurrences |
| Start | 5533081 |
| End | 5533100 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO581 genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGAGAGAGGAAAAAA(5' tail) CCCGCGC(5' stem) AGTTTA(loop) ACGCGGA(3' stem) ATTGGCGGTCACGCT(3' tail). Confidence: 91. overlap 5533082 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|