| Internal ID | 18502867 | Source Database | TransTermHP TERM 1005 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1005
|
| Sequence |
GCGGCGCCCTCATAGACGCCGG Look for more occurrences |
| Start | 4569873 |
| End | 4569894 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mandelii JR-1, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCAGCATAAAAAAAA(5' tail) CCGGCGTC(5' stem) TATGAG(loop) GGCGCCGC(3' stem) GTTTTTTTTTGCCTG(3' tail). Confidence: 100. opp_overlap 4569873 4569873 4569858 4569857, overlap 4569874 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|